answer questions below for the give two sequences based on information obtained from blast

Can you help me understand this Biology question?

answer questions below for the give two sequences

the video provided will help

Story:

A mysterious cruise boat was found with no survivors.

The detectives found a mysterious box with many biological samples.

They extracted DNA and sequenced those samples using different primer sets.

Your mission is to fill out the report file

In that report you have to write the results you obtain from BLASTing the sequences you were assigned

Then, following the instructions from the “Umbrella Corporation Confidential Researcher Report Form” write your hypothesis about what happened to the occupants of the cruise, based on your personal research about the organisms to which the DNA samples belonged.

https://www.youtube.com/watch?v=c7sSymQagLM&feature=youtu.be

>DNA_1_A

GAATACAATTAGTAAGTTCCAAAGATAATGCAAAAAAGATTACAGTTAATACTGATTTATTTAGACCTGATTGTATAACATTTTCATATAATGATAAATATTTTTCTCTATCACTTAGAGATGGAGATTATAATTGGATGATATGTAATGACAATAACAAGGTGCTAAAGGTGCACATTT

>DNA_1_B

GCTAGTGTAGCTTAATTTTAAAGCATGGCACTGAAGATGCTAATATGAAAAATGAGAATTTTCCGCAGGCATTAAGGTTTGGTCCTGGCCTCAGTATTAATTGTAACCAAAATTATACATGCAAGTTTCAGCATCCCTGTGAGAATGCCCTAACTACTCTATCAATTAGTTAGGAGCAGGTATCAGGCACACACTCACGTAGCCCAAGAC

Sec. 1: Nucleotide Sequence Information

Gene name or names (best match – list percent identity and e-value)

Gene product (protein, enzyme, miRNA, etc.)

Biological relevance

Relevance to incident being investigated for this report

Sec. 2: Blood Sample Information

Genetic Constituent(s)

Organism Identity or Identities

Biological relevance

Relevance to incident being investigated for this report

Sec. 3: Incident Assessment

Primary causative agent

Hypothesized method of action for causative agent

Potential long-term environmental hazards

Potential long-term human health hazards


Order the answer to view it

Assignment Solutions


Assignment Solutions

ORDER THIS OR A SIMILAR PAPER AND GET 20% DICOUNT. USE CODE: GET2O