Can you help me understand this Biology question?
answer questions below for the give two sequences
the video provided will help
Story:
A mysterious cruise boat was found with no survivors.
The detectives found a mysterious box with many biological samples.
They extracted DNA and sequenced those samples using different primer sets.
Your mission is to fill out the report file
In that report you have to write the results you obtain from BLASTing the sequences you were assigned
Then, following the instructions from the “Umbrella Corporation Confidential Researcher Report Form” write your hypothesis about what happened to the occupants of the cruise, based on your personal research about the organisms to which the DNA samples belonged.
https://www.youtube.com/watch?v=c7sSymQagLM&feature=youtu.be
>DNA_1_A
GAATACAATTAGTAAGTTCCAAAGATAATGCAAAAAAGATTACAGTTAATACTGATTTATTTAGACCTGATTGTATAACATTTTCATATAATGATAAATATTTTTCTCTATCACTTAGAGATGGAGATTATAATTGGATGATATGTAATGACAATAACAAGGTGCTAAAGGTGCACATTT
>DNA_1_B
GCTAGTGTAGCTTAATTTTAAAGCATGGCACTGAAGATGCTAATATGAAAAATGAGAATTTTCCGCAGGCATTAAGGTTTGGTCCTGGCCTCAGTATTAATTGTAACCAAAATTATACATGCAAGTTTCAGCATCCCTGTGAGAATGCCCTAACTACTCTATCAATTAGTTAGGAGCAGGTATCAGGCACACACTCACGTAGCCCAAGAC
|
Sec. 1: Nucleotide Sequence Information |
|
Gene name or names (best match – list percent identity and e-value) |
|
Gene product (protein, enzyme, miRNA, etc.) |
|
Biological relevance |
|
Relevance to incident being investigated for this report |
|
Sec. 2: Blood Sample Information |
|
Genetic Constituent(s) |
|
Organism Identity or Identities |
|
Biological relevance |
|
Relevance to incident being investigated for this report |
|
Sec. 3: Incident Assessment |
|
Primary causative agent |
|
Hypothesized method of action for causative agent |
|
Potential long-term environmental hazards |
|
Potential long-term human health hazards |
Order the answer to view it
